cellinjer och reagenser

både HeLa-och a549-celler beställdes från ATCC och odlades i Dulbeccos modifierade Eagle ’ s Medium (DMEM, Gibco 12800-017) innehållande 10% FBS (Hyklon SN30087.02). Antikropparna ifitm1, IFITM2 och IFITM3 beställdes från Cellsignaleringsteknik (13126 S), Proteintech-gruppen (66137-1-Ig) och Abgent (AP1153a). Anti-IFITM3 (polyklonal) 10088-604 var från VWR International. EGFR-antikropp var från Abcam (ab32077). TFR-antikroppen var från R&d-system (AF2474). Alexa-Fluor 488-CD63 (sc-5275) var från Santa Cruz Biotechnology. Influensa A-virus nukleoproteinantikropp (ab20343) var från Abcam. Alexa-Fluor 647 Antikroppsmärkningssats (A20186) beställdes från Life Technologies. De sekundära antikropparna HRP-konjugerad get anti-mus IgG (HCL) (115-035-003) och HRP-konjugerad get anti-kanin IGG (HCL) (111-035-003) köptes från Jackson ImmunoResearch. Får IGG pepparrotperoxidas-konjugerad antikropp (#HAF016) beställdes från Fisher Scientific. Anti-ha antikropp konjugerad till Alexa-Fluor 594 köptes från Life Technologies. Anti-HA HRP-konjugerad antikropp beställdes från Roche. Anti-calnexin (ab22595) var från Abcam. Dextran-Alexa-Fluor 488 (D22910), dextran-pHrodo-red (P10361), transferrin-Alexa-Fluor 647 (T23366) och rekombinant human EGF (10605hnae25) var från Life Technologies. Human holo-Transferrin (T0665) var från Sigma-Aldrich. Humant interferon-oc (IFN-oc, 8927sc) var från Cellsignaleringsteknik. Influensa A/PR/8 / 34 (H1N1) (10100374) var från Charles River Laboratories. Magic Red Cathepsin B Assay Kit (937) var från Immunokemi Technologies. Bafilomycin A1 (ab120497) var från Abcam. 6-TAMRA, speciell formulering (6-karboxitetrametylrhodamin, AS-81122) var från ANASPEC. QuikChange II Platsstyrd mutagenes Kit (#200523) var från Agilent Technologies. T7 Endonukleas I (M0302S) var från New England BioLabs.

plasmider

pEF-ifitm1, IFITM2, IFITM3 klonades genom PCR-amplifiering och infördes i en pef6-BSD-vektor. Alla mutanter av IFITM3 genererades med hjälp av QuikChange multi Site-Directed mutagenes Kit (Stratagene). PCAS9 plasmid och gRNA basic vector (pGL3-U6) var gåvor från W. Wei (Peking University)51.

t7e1-analys

celler lyserades för genomextraktion efter transfektion med gRNA-och cas9-plasmider för 60-72 h. gRNA-målstället förstärktes med användning av genom-PCR-primrar (hIFITM3-GF1: AGGAAACT GTTGAGAAACCGAA; hIFITM3-GR1: GCTAGTGGATAGCCGGGGAC). PCR-produkterna renades gel, följt av denaturering och glödgning. Glödgningsblandningen behandlades med T7-endonukleas I i 15 minuter vid 37 kcal C, och klyvningseffektiviteten övervakades sedan med gelelektrofores.

Generation och karakterisering av ifitm–mutanta cellinjer av CRISPR-Cas9

gRNA-plasmid konstruerades genom att införa gRNA-oligos i en pgl3-U6-vektor genom Golden Gate-ligering. Celler transfekterades med gRNA, pCas9 och pcDNA6-Puro med ett förhållande av 1:1:0,1 (UKG). Efter 48 h lossades cellerna och delades upp i två delar. En del lyserades för t7e1-analys för att kontrollera klyvningseffektiviteten hos specifika gRNA; en annan del återsåddes i sexbrunnsplattor vid olika utspädningar. Puromycin tillsattes för att välja de positiva klonerna. Efter urval i en vecka plockades de separerade cellkolonierna ut i en ny 24-brunnsplatta. Nya cellkolonier utvidgades och analyserades av western blot och genomsekvensering för att utvärdera knockout-effektiviteten.

för western blot-analys lysades celler med natriumdodecylsulfat (SDS) lysbuffert (2% SDS, 50 mM Tris, 2 mM EDTA) och kokades i 10 minuter vid 98 kcal C. För immunutfällning lysades celler med Brij-buffert (0.1 mM trietanolamin (TE), 150 mM NaCl, 1% BrijO10 (pH7.4)) innehållande EDTA-fri proteashämmare blandning, inkuberades sedan med anti-HA affinitetspärlor (Sigma). Alla primära antikroppar användes vid en 1:1000 utspädning och sekundär antikropp användes vid 1: 5000.

för genomisk sekvensering av ifitm-kloner extraherades totalt genom med användning av ett genomextraktionssats från QIAGEN. Den genomiska platsen för målet förstärktes av genspecifika primers. De förstärkta fragmenten tillsattes vid 3 ’ – änden av taq-polymeras och ligerades sedan med t-vektorer. Efter transformation plockades tio bakteriekolonier slumpmässigt och skickades för sekvensering.

virusinfektioner

a549, HeLa, Vero (WHO) och Huh-7.5 celler bibehölls i DMEM kompletterat med 10% FBS. A549-och HeLa-celler användes i funktionella studier (virusreplikationsanalyser), medan Vero-och Huh-7.5-celler användes för virusproduktion och virustitrering. Alla cellinjer testades negativt för kontaminering med mykoplasma och erhölls från ATCC (med undantag för Huh-7.5, som var från Chisari lab (Scripps Research Institute, La Jolla, CA)).

HeLa-eller A549-celler infekterades med influensa A/PR/8/34-virus (H1N1) vid en MOI på 2, 5 under 12 timmar. infekterade celler tvättades med PBS och skördades med 0, 25% trypsin-EDTA. Celler fixerades i 3,7% paraformaldehyd (PFA) under 10 min och genomträngdes med 0,1% Triton X-100 under 10 min. Celler färgades med anti-influensa nukleoprotein (NP) antikropp (1:333; Abcam, ab 20343) och konjugerades direkt till Alexa-Fluor 647 med användning av en 100 occyg antikropp märkning kit (Invitrogen). Alla antikroppar späddes i 0,1% Triton X-100 i PBS och celler färgades i 20 minuter. Celler tvättades två gånger med 0,1% Triton X-100 i PBS efter varje antikroppsbehandling. PBS användes för slutlig resuspension av celler för cytometrisk analys med hjälp av en FACS Canto II flödescytometer (BD Biosciences).

HeLa-eller A549-celler såddes i 24-brunnsplattor (5-104-celler/brunn) och inkuberades över natten (16-timmar) i närvaro eller frånvaro av IFN-oc-1 i en koncentration av 100 oc/mL. Därefter tvättades celler med Opti-MEM (Gibco) före infektion. Virus utspäddes i Opti-MEM vid den angivna MOIs, och celler inokulerades för 2 h vid 37 kcal C. Efter inkubation avlägsnades viralt inokulum och kulturer tvättades tre gånger med Opti-MEM innan DMEM tillsattes igen. Behandling med IFN-XX1 fortsatte under hela experimenten. Celler infekterade med GFP-märkta virus skördades vid angivna tidpunkter för att mäta infektion med flödescytometri. Genereringen av virusbestånd för följande virus har tidigare beskrivits: YFV-Venus52 (härledd från YF17D-5 ’ C25venus2aubi), WNV-GFP53 (härledd från pBELO-WNV-GFP-RZ ic), DENV-GFP54 (härledd från IC30P-A, en fullängds infektiös klon av stam 16681), VEEV-GFP55 (härledd från ptc83-GFP infektiös klon), ONNV-GFP56 (härledd från infektiös klon ponnv.GFP) och VSV-GFP (generöst tillhandahållen av J. Rose, Yale). ZIKV (PRVABC59 erhållen från CDC, Ft. Collins) förstärktes i Huh-7,5 celler och titrerades genom plackanalys på Huh-7,5 celler. Experiment med WNV utfördes i biosäkerhetsnivå 3 (BSL3) inneslutning i enlighet med institutionella och federala riktlinjer. Infekterade celler skördades i 300 occumaxl Accumax cell dissociation medium (eBioscience) och överfördes till ett 96-brunnsblock innehållande 300 occumaxl 4% PFA. Celler pelleterades vid 930 r. c. f.för 5 min vid 4 CCB, resuspended i kalla PBS innehållande 3% FBS, och lagras vid 4 CCB tills FACS analys. Celler infekterade med ZIKV skördades som beskrivits ovan och färgades därefter med användning av en monoklonal antikropp för flavivirusgruppsantigen 4G2 (Millipore) vid 1:500 som en primär antikropp och anti-kanin Alexa-Fluor 594 vid 1:1000 som en sekundär antikropp. Förutom celler skördades supernatanter från ZIKV-infektioner för att bestämma virustitrar genom standardplackanalys utförd på Huh-7.5-celler. Alla prover analyserades med hjälp av lsrii-flödescytometern (BD Biosciences) utrustad med en 488-nm och en 561-nm laser för detektering av GFP, YFP (Venus) och RFP. Data analyserades med hjälp av FlowJo-programvara (Treestar) med en 0.1% kompensationsmatris.

fluorescensmikroskopi

celler odlades på glasskydd i sexbrunnsplattor. Efter behandlingar tvättades cellerna med PBS två gånger, fixerades med 4% PFA i 10 min, permeabiliserades med 0,2% Triton X-100 i 10 min, blockerades med 1% bovint serumalbumin (BSA, Roche, 735094) i 1 h och inkuberades med primär antikroppskaninanti-IFITM3 (1:100 utspädd i 1% BSA; Proteintech group, 11714-1-AP) i 1,5 h, följt av sekundär antikropp anti-kanin-Alexa Fluor 647 konjugat (1:1000; ABCAM, ab150083) för 1 h vid rumstemperatur. Slutligen monterades täckglasen på glidbanor med monteringsmedium innehållande DAPI, och cellerna undersöktes med inverterat LSM 780 laserskanning konfokalt mikroskop (Zeiss).

exogena lastupptagningsanalyser

celler svältades i serum i 45 minuter vid 37 kcal C i DMEM och inkuberades sedan på IS i 5 minuter, vilket följdes av tillsats av 50 kg/ml Alexa-Fluor 647-konjugerat transferrin (Invitrogen) i DMEM. Efter 30 min på is, celler överfördes till 37 C i 7 min eller 20 min, pelleteras, tvättas i iskall PBS, syra-tvättas (0.1 M glycin och 150 mM NaCl vid pH 3) två gånger, tvättas med PBS en gång och fixeras (wt/vol 3% PFA och 4% sackaros i PBS) före flödescytometrisk analys, såsom beskrivits ovan.

analys av dfTAT-upptag och reduktion

syntes av dfTAT (dimerisk fluorescerande tat) av Y.-C. Wang var som tidigare beskrivet39. Efter förbehandling med eller utan 100 oc/ml IFN-OC i 16 h inkuberades celler med 2 oc dfTAT i DMEM under den angivna tiden, placerades på is och tvättades av iskall PBS tre gånger och fixerades (wt/vol 3% PFA och 4% sackaros i PBS) före flödescytometrisk analys eller fluorescensmikroskopi.

analys av EGFR-och TFR-omsättning

celler odlades till 80% sammanflöde, tvättades två gånger med PBS och svältades i serumfri DMEM för 2 h vid 37 kg C för att maximera ytan EGFR och förbehandlades sedan med 10-25 kg/ml cykloheximid för 1 timme i serumfri DMEM, vilket förhindrade syntes av ny EGFR under stimulering av EGF. Omedelbart efter stimulerades celler kontinuerligt med 100 ng/ml EGF för 15, 30, 60 eller 120 min i närvaro av cykloheximid. Nivåerna av EGFR och tubulin bestämdes genom western blotting. För cell-ytfärgningsexperiment inkuberades celler med primär Anti-EGFR-antikropp (Abcam, ab32077) på IS i 40 minuter och tvättades tre gånger med PBS. Alexa-Fluor 647-konjugerade sekundära antikroppar (Abcam, ab150083) inkuberades sedan med cellerna i 40 minuter på is och tvättades tre gånger med PBS. Celler suspenderades i 2% FBS i PBS och analyserades omedelbart via flödescytometri.

för TFR-omsättningsexperiment odlades celler till 80% sammanflöde, tvättades två gånger med PBS och svältades i serumfri DMEM i 2 timmar vid 37 kg c, förbehandlades sedan med 10-25 kg/ml cykloheximid i 1 timme i serumfri DMEM, vilket förhindrade syntes av ny TfR. Omedelbart efter stimulerades cellerna kontinuerligt med 20 kg / ml Tf för 0, 30, 60, 120 eller 180 min i närvaro av cykloheximid. Nivåerna av TfR, IFITM3 och tubulin bestämdes genom western blotting.

sen endosom-och lysosomfusionsanalys

celler inkuberades i 4 timmar i odlingsmedium innehållande 25 kg/ml pHrodo-röd dextran, följt av en 20 timmars jakt i fluorofor-fritt medium för att främja lysosomal ackumulering av dextran. Cellerna inkuberades sedan i medium innehållande 50 oc/ml dextran-Alexa Fluor 488 i 10 min vid 37 oc C innan de ersattes med fluorofor-fritt medium. Vid de angivna tidpunkterna fixerades celler med iskall 4% PFA för immunofluorescensfärgning.

lysosomala proteasaktivitetsanalyser

Cathepsin B-aktivitet analyserades med användning av cathepsin B-aktivitetssatsen enligt protokollet från tillverkaren. Efter behandling med IFN-26 h med eller utan bafilomycin A1 inkuberades celler med Magic Red (1:26) i 30-60 min vid 37 CG innan de tvättades två gånger med PBS. Celler fixerades sedan med användning av 4% PFA och analyserades med flödescytometri.

aktivitetsbaserad märkning av cathepsins (Vergent Bioscience, Pan Cathepsin probe) utfördes som tidigare rapporterats med mindre modifieringar57. I korthet såddes celler 24 timmar före Märkning och celler aktiverades med IFN-26 timmar före Märkning. Media ersattes, och celler behandlades med 1 oc iabp Pan Cathepsin sond för 2 h. celler tvättades med PBS och lyserades på is med en hypotonisk lysbuffert (50 mM rör pH 7,4, 10 mM KCl, 5 mM MgCl2, 2 mM EDTA, 4 mM DTT, 1% NP-40). Cellskräp avlägsnades genom att snurra ner lysater vid 500 kg i 5 minuter vid 4 kg C. Supernatanter blandades sedan med 4x provbelastningsbuffert och 70 kg totalt protein analyserades med SDS–PAGE. Gelen tvättades två gånger med avjoniserat vatten före fluorescensanalys i gel på ett Bio-Rad ChemiDoc MP-bildsystem och Coomassie-färgning eller överföring för western blot-analys.

did-märkning av virus

renat influensavirus A/PR/8/34 (H1N1) och rekombinant VSV-Uttryckande LASV GPC (genererat som tidigare beskrivet41) märktes med självsläckande koncentrationer av det lipofila färgämnet 1,1′-dioctactadecyl-3,3,3′,3′-tetrametylindodikarbocyanin (DiD, Life Technologies). Renat virus (1 mg/ml) i PBS inkuberades med 50 oc h DiD medan det omrördes i 1 h vid 4 oc C. Virus separerades från överskott av färgämne genom ultracentrifugering genom en 10% sackaroskudde i 2 h vid 107 000 oc g och 4 oc C med användning av en SW41-rotor (Beckman Coulter). Märkta viruspellets resuspenderades i PBS vid en viral proteinkoncentration av 1 mg/ml, alikvoterades och lagrades vid -80 kcal C tills användning.

platsspecifik märkning av IFITM3 i däggdjursceller

för levande cellbildningsstudier såddes HeLa-celler på 35 mm glasbotten för att vara ungefär 70% sammanflöde för avbildning nästa dag. Efter adherens transfekterades celler med plasmid av intresse innehållande en ha-IFITM3-TAG-variant (1 kg per skål) och Mm-PylRS-AF/Pyl-tRNACUA-plasmid (1 kg per skål) med användning av 3 kg viafect (Promega) i kompletta celltillväxtmedier innehållande onaturliga aminosyror (TCOK). Efter inkubation över natten ändrades cellmedier till färska celltillväxtmedier utan TCOK. Efter en annan 2 h-kultur vid 37 kg C / 5% CO2 märktes celler med tetrazin-fluoroforer (250 nM) i FluoroBrite DMEM (Life Technologies) i 30 minuter vid 37 kg C och tvättades med fullständigt celltillväxtmedium tre gånger över 1 timme.

levande cellavbildning

för bredfältsepifluorescensmikroskopi omvandlades celler med Cellljusvektorer (Life Technologies) för tidiga endosomer (RFP-Rab5), sena endosomer (RFP-Rab7) eller lysosomer (RFP-LAMP1) ungefär 18 timmar före avbildning enligt tillverkarens instruktioner. Levande cellmikroskopi utfördes som tidigare beskrivits med en AxioObserver.Z1 wide-field epifluorescence microscope (Zeiss) utrustad med en 40 acuc/ 1.3 N. A. objective, DAPI/GFP/Texas Red/Cy5 filteruppsättning och uppvärmd miljöhölje bibehållen vid 37 acuc C. HeLa cellmonolayers såddes på fibronektinbelagda 35 mm glas täckglas (MatTek) 24 timmar före experiment. Celler kyldes på IS i flera minuter före spinokulering av DiD-märkt virus på monolager vid 1,500 xnumx kg och 6 xnumx C för 20 min. Obundna partiklar avlägsnades genom fem tvättar med kalla PBS, och 500 oc kall avbildningsbuffert (140 mM NaCl, 2,5 mM KCl, 1,8 mM MgCl2, 20 mm HEPES, 5 mm sackaros, 2 oc h Hoechst 33342 och 2% FBS) tillsattes för att täcka cellerna. Skålen monterades omedelbart på mikroskopets mål och fokuserade. Täckglasskålen översvämmades sedan med 1.5 ml varm avbildningsbuffert för att markera experimentets början (t = 0). Bilder förvärvades varje 10 s under experimentets varaktighet med hjälp av en enda Z-sektion, som omfattade nästan alla cellassocierade partiklar.

för konfokalmikroskopi såddes HeLa-celler i 35 mm glasbotten (ibidi) och odlades över natten. Nästa dag transfekterades celler med plasmiden av intresse innehållande en ha-IFITM3-TAG-variant (1 kg per skål) och Mm-PylRS-AF/Pyl-tRNACUA-plasmid (1 kg per skål) med 6 kg lipofektamin 3000 i kompletta celltillväxtmedier innehållande TCOK. Efter 16 h inkubation ändrades cellmedier till färska celltillväxtmedier utan TCOK. Efter en annan 6 h-kultur vid 37 kg C / 5% CO2 märktes celler med tetrazin-BODIPY (500 nM) i FluoroBrite DMEM (Life Technologies)/10% FBS för 0,5 timmar vid 37 kg C och tvättades med FluoroBrite DMEM (Life Technologies)/10% FBS fyra gånger över 2 timmar. slutligen färgades celler med Nucblue Live Cell Stain (Life Technologies) i 20 minuter och avbildades i FluoroBrite DMEM/10% FBS med konfokalmikroskopi. För plasmamembranfärgning färgades celler med CellMask Röd (1:1,000, Life Technologies) i levande Cellbildningslösning (LCIS) i 5 min vid 37 xnumx C och tvättades med LCIS tre gånger före färgning med Nucblue Live Cell Stain. Celler avbildades på en inverterad LSM 780 laserskanning konfokalt mikroskop (Zeiss) med en Zeiss Plan-Apochromatic 63 2,4 xnumx xnumx N. A. olja nedsänkning mål. Mikroskopet var utrustat med en inkubatoruppsättning på 37 C/5% CO2 för levande cellavbildning. Hoechst var upphetsad med en 405 nm laser med emissionsspektra samlade mellan 410 nm och 480 nm. Tz-BODIPY var upphetsad med en 488 nm laser med emissionsspektra uppsamlad mellan 490 nm och 550 nm. CellMask Red var upphetsad med en 561 nm laser med emissionsspektra uppsamlad mellan 570 nm och 620 nm. Bilder förvärvades med Zen blue 2012-programvaran (Zeiss) och analyserades av ImageJ (NIH). Pearsons korrelationskoefficienter beräknades i ImageJ med Coloc 2-plugin.

dataanalys

bildanalys och enkelpartikelspårning utfördes med användning av volocity-programvara (PerkinElmer) som tidigare beskrivts41. Bildfiler manipulerades inte, förutom mindre justeringar i ljusstyrka och kontrast. Viral puncta tröskeldes av initial intensitet och storlek. Puncta som faller utanför intervallet 0,25 till 1 oc-m2 förväntat av enskilda DiD-märkta virioner utesluts från analys av enpartikel. Virioner ansågs colocalized med LAMP1 eller IFITM3 endast om den cellulära markören punctum överskred bakgrundssignalen med 30% eller mer och om GFP eller BODIPY och gjorde puncta Co-trafficked med mer än 70% överlappning av signaler. Genomsnittliga mätningar (s.d.) härleddes från tre separata experiment, om inte annat anges.

analys av ha-IFITM3-TCOK-uttrycksnivåer

för western blot-analys såddes HeLa-celler i sex-brunnsplattor och odlades över natten. Ifitm2 / 3-KO-celler transfekterades med HA-IFITM3-F8TAG (2,5 kg) och Mm-PylRS-AF/Pyl-tRNACUA (2,5 kg) i närvaro av TCOK (50 kg) under 16 timmar. Hela WT-celler lämnades obehandlade eller behandlades med IFN-kg (100 ng/ml) under 16 timmar. nivåerna av IFITM3 bestämdes genom western blotting med användning av kanin anti-IFITM3 (1:1 000; Proteintech group, 11714-1-AP) och sekundär antikropp HRP-konjugerad get anti-kanin IGG (HCL; 111-035-003).

för immunofluorescensanalys transfekterades ifitm2/3-KO-celler med HA-IFITM3-F8TAG (1 kg) Och Mm-PylRS-AF/Pyl-tRNACUA (1 kg) i närvaro av TCOK (50 kg) under 16 timmar. Hela WT-celler obehandlades eller behandlades med IFN-kg (100 ng/ml) under 16 timmar. celler fixerades sedan med formaldehyd, permeabiliserades med saponin (0,5%) och immunostained med kanin anti-IFITM3 (1:100) (proteintech grupp, 11714-1-AP) och anti-kanin-Alexa Fluor 647 konjugat (1:1,000) (Abcam, ab150083) för konfokal fluorescensavbildning. Hoescht (blå) används för att fläcka kärnor. Celler avbildades på ett inverterat LSM 780 laserscanning konfokalt mikroskop (Zeiss) med ett Zeiss-plan-Apokromatiskt 63 2.4-mål för nedsänkning av olja. Bilder togs under identiska konfokala mikroskopinställningar.

för flödescytometrianalys transfekterades IFITM2/3 KO-celler med HA-IFITM3-F8TAG (1 kg), Mm-PylRS-AF//Pyl-tRNACUA (1 kg), i närvaro av TCOK (50 kg) under 16 timmar. Hela WT-celler behandlades med eller utan IFN-ml (100 ng / ml) under 16 timmar. Cellerna tvättades två gånger med PBS och fixerades sedan med 400 occyl PBS med 4% PFA i 10 minuter. De fixerade cellerna permeabiliserades med 200 occl av 0,2% saponin i PBS för 10 min och blockerades sedan med 200 occl 0,2% BSA och 0,2% saponin i PBS för 10 min. Celler behandlades med kanin anti-IFITM3 (1:300) (Proteintech group, 11714-1-AP) och anti-kanin-Alexa Fluor 647 (1: 1000) (Abcam, ab150083) i PBS med 0,02% saponin. Efter tre tvättar med PBS, celler resuspended i 150 oc-ll PBS med 0,2% BSA och 0,02% saponin. Proverna analyserades med flödescytometri (BD LSRII). Dataanalys utfördes med hjälp av FLowJo programvara.

iav-infektion med IFITM3 Cys mutanter

ifitm2/3 KO HeLa-celler såddes i 12 brunnsplattor (Corning) och odlades över natten. Celler samtransfekterades med ha-hIFITM3-konstruktioner (1 kg/brunn) och Mm-PylRS-AF/Pyl-tRNA-plasmid (1 kg/brunn) med 3 kg Lipofektamin 3000 i 1 ml komplett celltillväxtmedium innehållande 10 kg 100 mm BocK (slutlig koncentration 1 mM). Efter 16 h infekterades celler med influensavirus A/PR/8/34-virus (H1N1) med MOI på 5. Efter 6 h infektion trypsiniserades celler och samlades i klusterrör (Corning). Cellerna tvättades två gånger med PBS och fixerades sedan med 400 occyl PBS med 4% PFA i 10 minuter. De fixerade cellerna permeabiliserades med 200 occl av 0,2% saponin i PBS för 10 min och blockerades sedan med 200 occl 0,2% BSA och 0,2% saponin i PBS för 10 min. Celler behandlades med anti-influensa NP-antikropp konjugerad till AlexaFluor-647 och anti-HA-antikropp konjugerad till Alexa-fluor-594 (1:250) i PBS med 0,02% saponin. Efter tre tvättar med PBS, celler resuspended i 150 oc-ll PBS med 0.2% BSA och 0.02% saponin. Proverna analyserades med flödescytometri (BD LSRII). Alla prover var först gated av HA-positiv färgning, vilket indikerar framgångsrik transfektion, och sedan NP-positiv procentandel av NP-positiv färgning, vilket indikerar framgångsrik infektion. HA-tag-epitopen härrör från en H3-influensavirusstam och finns inte i PR8-stammen av H1N1-influensavirus. Dataanalys utfördes med hjälp av FLowJo programvara.

s-palmitoyleringsanalyser

metabolisk märkning av celler med alkyn-palmitinsyrareporter alk-16 utfördes som tidigare beskrivet58 med vissa modifieringar. Alk-16 och az-rho syntetiserades som tidigare rapporterat58. IFITM2 / 3 KO HeLa-celler transfekterades med HA-hIFITM3-konstruktioner som beskrivits ovan. Efter 16 h inkuberades celler med 50 kg alk – 16 i DMEM innehållande 10% FBS för 2 timmar. celler skördades, tvättades en gång med PBS och lyserades i 1% Brij 97 (Sigma) i 50 mM TE, 150 mM NaCl pH 7.4, 1x Roche proteashämmare och 1500 enheter/ml bensonas (EMD). Proteinkoncentrationer bestämdes genom BCA-analysen. För immunoprecipitation, 150 µg av summa protein lades till 20 µl av anti-HA-antikropp-konjugerat agaros (Sigma) i en total volym av 150 µl och skakade på 4 °C under 1 h. Agaros pärlor spolades av resuspension i 500 µl 50 mM HEPES-buffert (innehållande 150 mM NaCl, pH 7.4) genom centrifugering vid 3500 × g i 30 s. Pärlorna var då resuspension i 45 µl av ovanstående buffert och 5 µl av CuAAC reaktant lösning (0.5 µl 10 mM azido-rhodamine (slutlig koncentration 100 µM), 1 µl 50 mM nylagad CuSO4·5H2O i H2O (slutlig koncentration av 1 mM, Sigma), 1 µl 50 mM nylagad TCEP (slutlig koncentration av 1 mM) och 2,5 µl 10 mM Trisamine (TBTA) (slutlig koncentration 500 µM)) lades till. Proverna rockades vid rumstemperatur i 1 h och tvättades två gånger med RIPA-buffert. Laemmli provbuffert (20 oC) tillsattes till proverna (1,0: 1,3 förhållande buffert till prov), som upphettades för 10 min vid 95 oc C och separerades med gelelektrofores. Fluorescensskanning i gel utfördes med användning av ett Bio-Rad ChemiDoc MP-bildsystem. Western blots för ha-taggade proteiner utfördes med användning av en anti-HA HRP konjugerad antikropp (1:1000; Roche). Kvantifiering av bandintensiteter i fluorescensgeler och västra blottar utfördes med Image Lab (Bio-Rad). Data från tre biologiska replikat kvantifierades och medelvärde för plottning.

rapportsammanfattning

ytterligare information om forskningsdesign finns i sammanfattningen Nature Research Reporting som är kopplad till denna artikel.

Posted on

Lämna ett svar

Din e-postadress kommer inte publiceras.