linii celulare și reactivi

atât celulele HeLa, cât și A549 au fost comandate de la ATCC și cultivate în mediul Eagle modificat de Dulbecco (DMEM, Gibco 12800-017) conținând 10% FBS (Hyclone SN30087.02). Anticorpii IFITM1, IFITM2 și IFITM3 au fost comandați din tehnologia de semnalizare celulară (13126 s), grupul Proteintech (66137-1-Ig) și Abgent (AP1153a). Anti-IFITM3 (policlonal) 10088-604 a fost de la VWR International. Anticorpul EGFR a fost de la Abcam (ab32077). Anticorpul TfR a fost din sistemele R &D (AF2474). Alexa-Fluor 488-CD63 (sc-5275) a fost de la Santa Cruz Biotehnologie. Anticorpul nucleoproteic al virusului gripal A (ab20343) a fost de la Abcam. Kitul de etichetare a anticorpilor Alexa-Fluor 647 (A20186) a fost comandat de la Life Technologies. Anticorpii secundari IgG anti-șoarece conjugat cu HRP (HCL) (115-035-003) și IgG anti-iepure conjugat cu HRP (HCL) (111-035-003) au fost achiziționați de la Jackson ImmunoResearch. Ovine IgG hrean peroxidază-anticorp conjugat (#HAF016) a fost comandat de la Fisher Scientific. Anticorpul anti-HA conjugat cu Alexa-Fluor 594 a fost achiziționat de la Life Technologies. Anticorpul conjugat anti-HA HRP a fost comandat de La Roche. Anti-calnexin (ab22595) a fost de la Abcam. Dextran-Alexa-Fluor 488 (D22910), dextran-pHrodo-roșu (P10361), transferrin-Alexa-Fluor 647 (T23366) și EGF uman recombinant (10605hnae25) provin din tehnologii de viață. Holo-transferina umană (T0665) a fost de la Sigma-Aldrich. Interferonul uman-inkt (IFN-inkt, 8927sc) provine din tehnologia de semnalizare celulară. Gripa a / PR / 8 / 34 (H1N1) (10100374) a fost de la laboratoarele Charles River. Magic Red Cathepsin B Kit de testare (937) a fost de la tehnologii imunochimie. Bafilomicina A1 (ab120497) a fost de la Abcam. 6-TAMRA, formulare specială (6-carboxitetrametilrodamină, AS-81122) a fost de la ANASPEC. Quikchange ii Kit de mutageneză direcționat pe Site (#200523) a fost de la Agilent Technologies. T7 Endonucleaza I (M0302S) a fost din New England BioLabs.

plasmidele

pEF-IFITM1, IFITM2, IFITM3 au fost clonate prin amplificare PCR și inserate într-un vector pEF6-BSD. Toți mutanții IFITM3 au fost generați utilizând kitul de mutageneză QuikChange Multi-Site (Stratagene). Plasmida pCAS9 și vectorul de bază gRNA (pGL3-U6) au fost Cadouri de la W. Wei (Universitatea Peking)51.

t7e1 test

celulele au fost lizate pentru extracția genomului după transfecție cu plasmide gRNA și cas9 timp de 60-72 ore. site-ul țintă al gRNA a fost amplificat prin utilizarea primerilor PCR genomului (hIFITM3-GF1: AGGAAACT GTTGAGAAACCGAA; hIFITM3-GR1: GCTAGTGGATAGCCGGGGAC). Produsele PCR au fost purificate în gel, urmate de denaturare și recoacere. Amestecul de recoacere a fost tratat cu endonuclează T7 I timp de 15 min la 37 centi C, iar eficiența scindării a fost apoi monitorizată prin electroforeză în gel.

generarea și caracterizarea liniilor celulare mutante IFITM prin CRISPR–Cas9

plasmida gRNA a fost construită prin inserarea oligosului gRNA într-un vector pGL3-U6 prin ligarea Golden Gate. Celulele au fost transfectate cu gRNA, pCas9 și pcDNA6-Puro cu un raport de 1: 1: 0,1 (hectolitri). După 48 de ore, celulele au fost detașate și împărțite în două părți. O parte a fost lizată pentru testul T7E1 pentru a verifica eficiența de scindare a grna specifice; o altă parte a fost resigilată în plăci cu șase puțuri la diluții diferite. Puromicina a fost adăugată pentru a selecta clonele pozitive. După selecție timp de o săptămână, coloniile de celule separate au fost selectate într-o nouă placă de 24 de puțuri. Noile colonii de celule au fost extinse și analizate prin Western blot și secvențierea genomului pentru a evalua eficiența knockout-ului.

pentru analiza western blot, celulele au fost lizate cu tampon de liză de dodecilsulfat de sodiu (SDS) (2% SDS, 50 mm Tris, 2 mm EDTA) și fierte timp de 10 min la 98 C. Pentru imunoprecipitare, celulele au fost lizate cu tampon Brij (0.1 mM trietanolamină( ceai), 150 mM Naci, 1% BrijO10 (pH7.4)) conținând amestec inhibitor de protează fără EDTA, apoi incubat cu bile de afinitate anti-HA (Sigma). Toți anticorpii primari au fost utilizați la o diluție de 1:1000, iar anticorpul secundar a fost utilizat la 1:5000.

pentru secvențierea genomică a clonelor IFITM, genomul total a fost extras folosind un kit de extracție a genomului din QIAGEN. Site-ul genomic țintă a fost amplificat de primeri specifici genei. Fragmentele amplificate au fost adăugate la capătul 3 ‘ de polimeraza taq și apoi ligate cu vectori T. După transformare, zece colonii de bacterii au fost culese aleatoriu și trimise pentru secvențiere.

infecțiile virale

celulele A549, HeLa, Vero (OMS) și Huh-7,5 au fost menținute în DMEM suplimentat cu 10% FBS. Celulele A549 și hela au fost utilizate în studii funcționale (teste de replicare virală), în timp ce celulele Vero și Huh-7.5 au fost utilizate pentru producerea virusului și titrarea virusului. Toate liniile celulare au fost testate negativ pentru contaminarea cu micoplasma și au fost obținute de la ATCC (cu excepția Huh-7.5, care a fost de la laboratorul Chisari (Scripps Research Institute, La Jolla, CA)).

celulele HeLa sau a549 au fost infectate cu virusul gripal A/PR/8/34 (H1N1) la un MOI de 2,5 timp de 12 ore. celulele infectate au fost spălate cu PBS și recoltate folosind 0,25% tripsină-EDTA. Celulele au fost fixate în 3,7% paraformaldehidă (PFA) timp de 10 minute și permeate cu 0,1% Triton X-100 timp de 10 minute. Celulele au fost colorate cu anticorpi nucleoproteici antigripali (NP) (1:333; Abcam, ab 20343) și conjugate direct cu Alexa-Fluor 647 folosind un kit de etichetare a anticorpilor 100 de la un număr de 100 de la un număr de anticorpi (Invitrogen). Toți anticorpii au fost diluați în 0,1% Triton X-100 în PBS, iar celulele au fost colorate timp de 20 de minute. Celulele au fost spălate de două ori cu 0,1% Triton X-100 în PBS după fiecare tratament cu anticorpi. PBS a fost utilizat pentru resuspensia finală a celulelor pentru analiza citometrică utilizând un Citometru de flux FACS Canto II (BD Biosciences).

celulele HeLa sau a549 au fost însămânțate în plăci cu 24 de godeuri (5 0,104 celule/godeu) și incubate peste noapte (16 ore) în prezența sau absența IFN-0,1 la o concentrație de 100 de grame/mL. Apoi, celulele au fost spălate cu Opti-mem (Gibco) înainte de infecție. Virusurile au fost diluate în Opti-mem la MOIs indicat, iar celulele au fost inoculate timp de 2 ore la 37 C. După incubare, inoculul viral a fost îndepărtat, iar culturile au fost spălate de trei ori cu Opti-mem înainte ca DMEM să fie re-adăugat. Tratamentul cu IFN-XV1 a fost continuat pe parcursul experimentelor. Celulele infectate cu virusuri marcate cu GFP au fost recoltate la punctele de timp indicate pentru a măsura infecția prin citometrie în flux. Generarea de stocuri virale pentru următoarele virusuri a fost descrisă anterior: YFV-Venus52 (derivat din yf17d-5 ‘ C25venus2aubi), WNV-GFP53 (derivat din pbelo-WNV-GFP-RZ ic), DENV-Gfp54 (derivat din IC30P-A, o clonă infecțioasă de lungime întreagă a tulpinii 16681), VEEV-GFP55 (derivat din pTC83-GFP clonă infecțioasă), ONNV-GFP56 (derivat de la clona infecțioasă ponnv.GFP) și VSV-GFP (oferit cu generozitate de J. Rose, Yale). ZIKV (PRVABC59 obținut de la CDC, Ft. Collins) a fost amplificat în Huh-7,5 celule și titrat prin testul plăcii pe Huh-7,5 celule. Experimentele cu WNV au fost efectuate în izolarea nivelului de biosecuritate 3 (BSL3) în conformitate cu orientările instituționale și federale. Celulele infectate au fost recoltate într-un mediu de disociere a celulelor Accumax de 300 XL (eBioscience) și transferate într-un bloc de 96 de puțuri care conține 300 XL 4% PFA. Celulele au fost granulate la 930 r.c. f.timp de 5 min la 4 CTC, omogenizate în PBS la rece conținând 3% FBS și depozitate la 4 CTC până la analiza FACS. Celulele infectate cu ZIKV au fost recoltate conform descrierii de mai sus și ulterior colorate folosind un anticorp monoclonal pentru antigenul grupului flavivirus 4G2 (Millipore) la 1:500 ca anticorp primar și anti-iepure Alexa-Fluor 594 la 1: 1.000 ca anticorp secundar. În plus față de celule, supernatanții din infecțiile cu ZIKV au fost recoltați pentru a determina titrurile virale prin testul standard de placă efectuat pe celulele Huh-7.5. Toate probele au fost analizate folosind citometrul de flux lsrii (bd Biosciences) echipat cu un laser de 488 nm și 561 nm pentru detectarea GFP, YFP (Venus) și RFP. Datele au fost analizate folosind software-ul FlowJo (Treestar) cu o matrice de compensare de 0,1%.

microscopie fluorescentă

celulele au fost cultivate pe capace de sticlă în plăci cu șase puțuri. După tratamente, celulele au fost spălate cu PBS de două ori, fixate cu 4% PFA timp de 10 minute, permeabilizate cu 0,2% Triton X-100 timp de 10 minute, blocate cu 1% albumină serică bovină (BSA, Roche, 735094) timp de 1 oră și incubate cu anticorpi primari rabbit anti-IFITM3 (1:100 diluat în 1% BSA; grupul Proteintech, 11714-1-AP) timp de 1,5 ore, urmate conjugat fluor 647 (1:1000; abcam, ab150083) timp de 1 oră la temperatura camerei. În cele din urmă, capacele au fost montate pe diapozitive folosind un mediu de montare care conține DAPI, iar celulele au fost examinate prin microscopul confocal cu scanare laser LSM 780 inversat (Zeiss).

teste exogene de absorbție a încărcăturii

celulele au fost înfometate seric timp de 45 min la 37 centicc în DMEM și apoi incubate pe gheață timp de 5 min, care a fost urmată de adăugarea a 50 centicg/ml transferină conjugată Alexa-Fluor 647 (Invitrogen) în DMEM. După 30 min pe gheață, celulele au fost transferate la 37 centimetric C timp de 7 min sau 20 min, peletate, spălate în PBS rece ca gheața, spălate cu acid (0.1 m glicină și 150 mM NaCI la pH 3) de două ori, spălate cu PBS o dată și fixate (wt/vol 3% PFA și 4% zaharoză în PBS) înainte de analiza citometrică în flux, conform descrierii de mai sus.

analiza absorbției și reducerii dfTAT

sinteza dfTAT (tat fluorescent dimeric) de către Y.-C. Wang a fost descrisă anterior39. După pretratament cu sau fără 100 hectolitri/ml IFN-hectolitri timp de 16 ore, celulele au fost incubate cu 2 mmdftat în DMEM pentru timpul indicat, plasate pe gheață și spălate de trei ori cu PBS rece ca gheața și fixate (wt/vol 3% PFA și 4% zaharoză în PBS) înainte de analiza citometrică în flux sau microscopia fluorescentă.

analiza cifrei de afaceri EGFR și TfR

celulele au fost cultivate la confluență de 80%, spălate de două ori cu PBS și înfometate în DMEM fără ser timp de 2 ore la 37 CTC pentru a maximiza EGFR de suprafață și apoi pretratate cu 10-25 CMC/ml cicloheximidă timp de 1 oră în DMEM fără ser, prevenind sinteza de noi EGFR în timpul stimulării prin EGF. Imediat după aceea, celulele au fost stimulate continuu cu 100 ng / ml EGF timp de 15, 30, 60 sau 120 min în prezența cicloheximidei. Nivelurile de EGFR și tubulină au fost determinate de western blotting. Pentru experimentele de colorare a suprafeței celulare, celulele au fost incubate cu anticorp anti-EGFR primar (Abcam, ab32077) pe gheață timp de 40 min și spălate de trei ori cu PBS. Anticorpii secundari conjugați Alexa-Fluor 647 (Abcam, ab150083) au fost apoi incubați cu celulele timp de 40 min pe gheață și spălați de trei ori cu PBS. Celulele au fost suspendate în 2% FBS în PBS și analizate imediat prin citometrie în flux.

pentru experimentele de turnover TfR, celulele au fost cultivate la confluență de 80%, spălate de două ori cu PBS și înfometate în DMEM fără ser timp de 2 ore la 37 CTC, apoi pretratate cu 10-25 CTC/ml cicloheximidă timp de 1 oră în DMEM fără ser, prevenind sinteza de noi TfR. Imediat după aceea, celulele au fost stimulate în mod continuu cu 20 hectogg/ml Tf timp de 0, 30, 60, 120 sau 180 min în prezența cicloheximidei. Nivelurile de TfR, IFITM3 și tubulină au fost determinate prin western blotting.

testul de fuziune cu endozomi tardivi și lizozomi

celulele au fost incubate timp de 4 ore în mediu de cultură conținând 25 de ore de dextran Frodo-roșu, urmat de o urmărire de 20 de ore în mediu fără fluorofori pentru a favoriza acumularea lizozomală de dextran. Celulele au fost apoi incubate într-un mediu conținând 50%/ml dextran-Alexa Fluor 488 timp de 10 min la 37% C înainte de înlocuirea cu un mediu fără fluorofori. La punctele de timp observate, celulele au fost fixate cu 4% PFA rece ca gheața pentru colorarea imunofluorescenței.

teste de activitate a proteazei lizozomale

activitatea catepsinei B a fost testată folosind kitul de activitate al catepsinei b, urmând protocolul furnizat de producător. După tratamentul cu IFN-XV timp de 16 ore cu sau fără bafilomicină A1, celulele au fost incubate cu roșu Magic (1:26) timp de 30-60 min la 37 CTC înainte de a fi spălate de două ori cu PBS. Celulele au fost apoi fixate folosind 4% PFA și analizate prin citometrie în flux.

etichetarea Catepsinelor pe bază de activitate (Vergent Bioscience, Pan catepsin probe) a fost efectuată așa cum s-a raportat anterior cu modificări minore57. Pe scurt, celulele au fost însămânțate cu 24 de ore înainte de etichetare, iar celulele au fost activate cu IFN-16 h înainte de etichetare. Mediile au fost înlocuite, iar celulele au fost tratate cu 1 sondă de catepsină iabp Iabp timp de 2 ore. celulele au fost spălate cu PBS și lizate pe gheață cu un tampon de liză hipotonică (țevi de 50 mM pH 7,4, 10 mm KCl, 5 mM MgCl2, 2 mm EDTA, 4 mM DTT, 1% NP-40). Resturile celulare au fost îndepărtate prin filare în jos lizați la 500 centimetric g timp de 5 min la 4 centimetric C. Supernatanții au fost apoi amestecați cu 4x tampon de încărcare a probei, iar 70 centimetric de proteină totală a fost analizat prin SDS–PAGE. Gelul a fost spălat de două ori cu apă deionizată înainte de analiza fluorescenței în gel pe un sistem de imagistică Bio-Rad ChemiDoc MP și colorare Coomassie sau transfer pentru analiza western blot.

etichetarea DiD a virusurilor

virusul gripal purificat a/PR/8/34 (H1N1) și vsv recombinant care exprimă LASV GPC (generat așa cum s-a descris anterior41) au fost etichetate cu concentrații de auto-stingere a colorantului lipofil 1,1′-dioctactadecil-3,3,3′,3′-tetrametilindodicarbocianină (DiD, tehnologii de viață). Virusul purificat (1 mg / ml) în PBS a fost incubat cu DiD de 50 mm în timp ce era agitat timp de 1 oră la 4 MMC.C. Virusul a fost separat de excesul de colorant prin ultracentrifugare printr-o pernă de zaharoză de 10% Timp de 2 ore la 107.000 MMC. g și 4 MMC. C folosind un rotor SW41 (Beckman Coulter). Peletele de virus etichetate au fost omogenizate în PBS la o concentrație de proteine virale de 1 mg/ml, alicotate și depozitate la -80 CTC până la utilizare.

etichetarea specifică site-ului IFITM3 în celulele de mamifere

pentru studiile de imagistică cu celule vii, celulele HeLa au fost însămânțate pe vase cu fund de sticlă de 35 mm pentru a fi la aproximativ 70% confluență pentru imagistică a doua zi. În urma aderenței, celulele au fost transfectate cu plasmida de interes care conține o variantă HA-IFITM3-TAG (1 hectolitru pe vas) și plasmida Mm-PylRS-AF/Pyl-tRNACUA (1 hectolitru pe vas) utilizând 3 centicl Viafect (Promega) în medii complete de creștere celulară care conțin aminoacizi nenatural (TCOK). După incubarea peste noapte, mediile celulare au fost schimbate în medii proaspete de creștere celulară fără TCOK. După o altă cultură de 2 ore la 37 C/5% CO2, celulele au fost etichetate cu tetrazină-fluorofori (250 nM) în FLUOROBRIT DMEM (tehnologii de viață) timp de 30 min la 37 C și spălate cu medii complete de creștere celulară de trei ori peste 1 oră.

imagistica cu celule vii

pentru microscopia cu epifluorescență cu câmp larg, celulele au fost transduse cu vectori de lumină celulară (tehnologii de viață) pentru endozomii timpurii (RFP-Rab5), endozomii tardivi (RFP-Rab7) sau lizozomii (RFP-LAMP1) cu aproximativ 18 ore înainte de imagistică, conform instrucțiunilor producătorului. Microscopia cu celule vii a fost efectuată așa cum a fost descris anterior cu un AxioObserver.Microscop cu epifluorescență cu câmp larg Z1 (Zeiss) echipat cu un obiectiv de 40 oz/ 1.3 N. A., set de filtre DAPI/GFP/Texas Red/Cy5 și incintă de mediu încălzită menținută la 37 C. Monostraturile de celule HeLa au fost însămânțate pe plăci de acoperire din sticlă de 35 mm acoperite cu fibronectină (MatTek) cu 24 de ore înainte de experimente. Celulele au fost refrigerate pe gheață timp de câteva minute înainte de spinocularea virusului marcat cu DiD pe monostraturi la 1.500 centimetric g și 6 centimetric C timp de 20 min. Particulele nelegate au fost îndepărtate prin cinci spălări cu PBS rece și s-a adăugat un tampon de imagistică la rece de 500 ilqql (140 mM NaCl, 2,5 mM KCl, 1,8 mM MgCl2, 20 mm HEPES, 5 mm zaharoză, 2 ilqqm Hoechst 33342 și 2% FBS) pentru a acoperi celulele. Antena a fost montată imediat pe obiectivul microscopului și focalizată. Vasul de acoperire a fost apoi inundat cu 1.Tampon imagistic cald de 5 ml pentru a marca începutul experimentelor (t = 0). Imaginile au fost obținute la fiecare 10 s pe durata experimentelor folosind o singură secțiune Z, care cuprindea aproape toate particulele asociate celulelor.

pentru microscopie confocală, celulele HeLa au fost însămânțate în vase cu fund de sticlă de 35 mm (ibidi) și cultivate peste noapte. A doua zi, celulele au fost transfectate cu plasmida de interes care conține o variantă HA-IFITM3-TAG (1 hectolitru pe vas) și plasmida Mm-PylRS-AF/Pyl-tRNACUA (1 hectolitru pe vas) folosind 6 centicl Lipofectamină 3000 în medii complete de creștere celulară care conțin TCOK. După incubarea 16 h, mediile celulare au fost schimbate în medii proaspete de creștere celulară fără TCOK. După o altă cultură de 6 ore la 37 C/5% CO2, celulele au fost etichetate cu tetrazină-BODIPIE (500 nM) în Fluorobrit DMEM(Life Technologies) / 10% FBS pentru 0,5 h la 37 C și spălate cu Fluorobrit DMEM(Life Technologies) / 10% FBS de patru ori peste 2 h. în cele din urmă, celulele au fost colorate cu NucBlue live Cell Stain (Life Technologies) timp de 20 microscopie. Pentru colorarea membranei plasmatice, celulele au fost colorate cu CellMask roșu (1:1.000, Life Technologies) în soluție de imagistică cu celule vii (LCIS) timp de 5 min la 37 C și spălată cu LCIS de trei ori înainte de colorare cu pata de celule vii NucBlue. Celulele au fost imaginate pe un microscop confocal cu scanare laser LSM 780 inversat (Zeiss) cu un plan Zeiss-obiectiv Apocromatic 63 Irak/1.4 N. A. imersiune în ulei. Microscopul a fost echipat cu un incubator stage-top setat la 37 ct/5% CO2 pentru imagistica cu celule vii. Hoechst a fost excitat cu un laser de 405 nm cu spectre de emisie colectate între 410 nm și 480 nm. TZ-BODIPY a fost excitat cu un laser de 488 nm cu spectre de emisie colectate între 490 nm și 550 nm. CellMask Red a fost excitat cu un laser de 561 nm cu spectre de emisie colectate între 570 nm și 620 nm. Imaginile au fost achiziționate cu software-ul ZEN blue 2012 (Zeiss) și analizate de ImageJ (NIH). Coeficienții de corelație ai lui Pearson au fost calculați în ImageJ folosind pluginul Coloc 2.

analiza datelor

analiza imaginii și urmărirea cu o singură particulă au fost efectuate folosind software-ul Volocity (PerkinElmer) așa cum s-a descris anterior41. Fișierele de imagine nu au fost manipulate, în afară de ajustări minore ale luminozității și contrastului. Punctele virale au fost pragate de intensitatea și dimensiunea inițială. Puncta care se încadrează în afara intervalului de 0,25 până la 1 mmc2 așteptat de virioni individuali marcați cu DiD au fost excluși din analiza cu o singură particulă. Virionii au fost considerați colocalizați cu LAMP1 sau IFITM3 numai dacă markerul celular punctum a depășit semnalul de fundal cu 30% sau mai mult și dacă GFP sau BODIPY și a făcut puncta co-traficat cu o suprapunere mai mare de 70% a semnalelor. Măsurători medii (s.d.) au fost derivate din trei experimente separate, cu excepția cazului în care se indică altfel.

analiza nivelurilor de Expresie HA-IFITM3-TCOK

pentru analiza western blot, celulele HeLa au fost însămânțate în plăci cu șase puțuri și cultivate peste noapte. Celulele IFITM2/3-KO au fost transfectate cu HA-IFITM3-F8TAG (2,5%) și Mm-PylRS-AF/Pyl-tRNACUA (2,5%) în prezența TCOK (50%) timp de 16 ore. celulele hela WT au fost lăsate netratate sau tratate cu IFN-XV (100 ng/ml) timp de 16 ore. nivelurile de IFITM3 au fost determinate prin western blotting folosind anti-ifitm3 de iepure (1:1, 000; Proteintech group, 11714-1-AP) și anticorp secundar IgG anti-iepure conjugat cu HRP de capră (HCL; 111-035-003).

pentru analiza imunofluorescenței, celulele IFITM2/3-KO au fost transfectate cu HA-IFITM3-F8TAG (1 ectg) și Mm-PylRS-AF/Pyl-tRNACUA (1 hectolitru) în prezența TCOK (50 hectolitru) timp de 16 ore. celulele hela WT au fost netratate sau tratate cu IFN-October (100 ng/ml) timp de 16 ore. celulele au fost apoi fixate cu formaldehidă, permeabilizate cu saponina (0,5%), și imunostained cu iepure anti-ifitm3 (1:100) (PROTEINTECH Group, 11714-1-AP) și anti-iepure-Alexa fluor 647 conjugat (1:1.000) (Abcam, ab150083) pentru imagistica prin fluorescență confocală. Hoescht (albastru) este folosit pentru a pata nucleele. Celulele au fost imaginate pe un microscop confocal cu scanare laser LSM 780 inversat (Zeiss) cu un obiectiv Zeiss plan-Apocromatic 63 inkt/1.4 de imersie în ulei. Imaginile au fost realizate sub Setări identice ale microscopului confocal.

pentru analiza citometriei în flux, celulele IFITM2/3 KO au fost transfectate cu HA-IFITM3-F8TAG (1 hectolitru), Mm-PylRS-AF//fotoliul-tRNACUA (1 hectolitru), în prezența TCOK (50 fotoliul) timp de 16 ore. celulele hela WT au fost tratate cu sau fără fotoliul IFN-October (100 ng/ml) timp de 16 ore. Celulele au fost spălate de două ori cu PBS și apoi fixate cu 400 unqql de PBS cu 4% PFA timp de 10 min. Celulele fixe au fost permeabilizate cu 200 xqtl de 0,2% saponină în PBS timp de 10 min și apoi blocate cu 200 XTL 0,2% BSA și 0,2% saponină în PBS timp de 10 min. Celulele au fost tratate cu iepure anti-IFITM3 (1:300) (grupul Proteintech, 11714-1-AP) și anti-iepure-Alexa Fluor 647 (1: 1.000) (Abcam, ab150083) în PBS cu 0,02% saponină. După trei spălări cu PBS, celulele au fost resuspendate în 150 xqql PBS cu 0,2% BSA și 0,02% saponină. Probele au fost analizate prin citometrie în flux (BD LSRII). Analiza datelor a fost efectuată utilizând software-ul FLowJo.

infecția IAV cu mutanți CYS IFITM3

celulele IFITM2/3 KO HeLa au fost însămânțate în 12 plăci de sondă (Corning) și cultivate peste noapte. Celulele au fost co-transfectate cu constructe HA-hIFITM3 (1 hectolitru/godeu) și plasmida Mm-PylRS-AF/Pyl-Tarn (1 hectolitru/godeu) utilizând 3 ilft Lipofectamină 3000 în 1 ml de medii complete de creștere celulară conținând 10 ilft de 100 mm BocK (concentrație finală 1 mM). După 16 ore, celulele au fost infectate cu virusul gripal A/PR/8/34 (H1N1) cu MOI de 5. După 6 ore de infecție, celulele au fost tripsinizate și colectate în tuburi de cluster (Corning). Celulele au fost spălate de două ori cu PBS și apoi fixate cu 400 unqql de PBS cu 4% PFA timp de 10 min. Celulele fixe au fost permeabilizate cu 200 xqtl de 0,2% saponină în PBS timp de 10 min și apoi blocate cu 200 XTL 0,2% BSA și 0,2% saponină în PBS timp de 10 min. Celulele au fost tratate cu anticorp NP anti-gripal conjugat cu AlexaFluor – 647 și anticorp anti-HA conjugat cu Alexa-fluor-594 (1:250) în PBS cu 0,02% saponină. După trei spălări cu PBS, celulele au fost resuspendate în 150 unqql PBS cu 0,2% BSA și 0.02% saponină. Probele au fost analizate prin citometrie în flux (BD LSRII). Toate probele au fost mai întâi închise prin colorare HA-pozitivă, indicând transfecția reușită și apoi procentul NP-pozitiv al colorării NP-pozitive, indicând infecția reușită. Epitopul ha-tag este derivat dintr-o tulpină de virus gripal H3 și nu este prezent în tulpina PR8 a virusului gripal H1N1. Analiza datelor a fost efectuată utilizând software-ul FLowJo.

s-palmitoylation teste

etichetarea metabolică a celulelor cu alchin-palmitic acid reporter alk-16 a fost efectuată așa cum sa descris anterior58 cu unele modificări. Alk-16 și AZ-rho au fost sintetizate conform raportului anterior58. Celulele IFITM2 / 3 KO HeLa au fost transfectate cu constructe HA-hIFITM3 așa cum este descris mai sus. După 16 ore, celulele au fost incubate cu 50 mm ALK – 16 în DMEM conținând 10% FBS timp de 2 ore. celulele au fost recoltate, spălate o dată cu PBS și lizate în 1% Brij 97 (Sigma) în ceai de 50 mM, 150 mm NaCl pH 7,4, 1x inhibitor de protează Roche și 1.500 unități/ml benzonază (EMD). Concentrațiile de proteine au fost determinate prin testul BCA. Pentru immunoprecipitation, 150 µg de proteină totală a fost adaugat la 20 µl de anticorpul anti-HA-conjugat de agaroză (Sigma) într-un volum total de 150 µl și zguduit la 4 °C timp de 1 h. Agaroză margele au fost spălate de omogenizare în 500 µl de 50 mM tampon HEPES (conținând 150 mM NaCl, pH 7.4) prin centrifugare la 3500 × g timp de 30 s. Perlele au fost apoi suspensia va fi omogenizată, în 45 µl de mai sus tampon și 5 µl de CuAAC reactant soluție (0.5 µl de 10 mM azido-rodamină (concentrație finală 100 µM), 1 µl de 50 mM proaspăt preparate CuSO4·5H2O în H2O (concentrație finală de 1 mM, Sigma), 1 µl de 50 mM proaspăt preparate TCEP (concentrație finală de 1 mM) și 2,5 µl de 10 mM Trisamine (TBTA) (concentrație finală de 500 µM)) a fost adăugat. Probele au fost rotite la temperatura camerei timp de 1 oră și spălate de două ori cu tampon RIPA. La probe s-a adăugat tampon de probă Laemmli (20 xqtl) (raport 1,0:1,3 tampon la probă), care au fost încălzite timp de 10 min la 95 xtcc și separate prin electroforeză în gel. Scanarea fluorescenței în gel a fost efectuată utilizând un sistem de imagistică Bio-Rad ChemiDoc MP. Western blots pentru proteinele etichetate HA au fost efectuate folosind un anticorp conjugat anti-HA HRP (1: 1.000; Roche). Cuantificarea intensităților benzilor în gelurile fluorescente și western blots s-a efectuat cu Image Lab (Bio-Rad). Datele din trei replici biologice au fost cuantificate și medii pentru complot.

rezumat de raportare

informații suplimentare privind proiectarea cercetării sunt disponibile în Rezumatul de raportare privind cercetarea naturii legat de acest articol.

Posted on

Lasă un răspuns

Adresa ta de email nu va fi publicată.