sejtvonalak és reagensek

mind a HeLa, mind az A549 sejteket ATCC-ből rendelték és tenyésztették Dulbecco módosított Eagle Táptalajában (DMEM, Gibco 12800-017), amely 10% FBS-t (Hyclone SN30087.02). Az IFITM1, IFITM2 és IFITM3 antitesteket a Cell Signaling Technology (13126 S), a Proteintech group (66137-1-Ig) és az Abgent (AP1153a) csoportokból rendelték. Az anti-IFITM3 (poliklonális) 10088-604 a VWR International-től származik. Az EGFR antitest az Abcam-ból származott (ab32077). A TfR antitest R&D rendszerekből származott (AF2474). Az Alexa-Fluor 488-CD63 (sc-5275) a Santa Cruz Biotechnológiából származik. Az Influenza a vírus nukleoprotein antitestje (ab20343) az Abcam-ból származott. Az Alexa-Fluor 647 antitest címkéző készletet (A20186) a Life Technologies-től rendelték meg. A másodlagos antitestek HRP-konjugált kecske anti-egér IgG (HCL) (115-035-003) és HRP-konjugált kecske anti-nyúl IgG (HCL) (111-035-003) vásároltak Jackson ImmunoResearch. Juh IgG torma peroxidáz-konjugált antitest (#HAF016) rendelték Fisher Scientific. Az Alexa-Fluor 594-hez konjugált anti-ha antitestet a Life Technologies-től vásárolták. Anti – HA HRP-konjugált antitestet rendeltek a Roche-tól. Az Anti-kalnexin (ab22595) az Abcam-ból származik. A dextrán-Alexa-Fluor 488 (D22910), dextrán-pHrodo-red (P10361), transzferrin-Alexa-Fluor 647 (T23366) és rekombináns humán EGF (10605hnae25) a Life Technologies-tól származnak. Az emberi holo-transzferrin (T0665) Sigma-Aldrichből származott. A humán interferon-6 (IFN-6927sc) a sejtjelzés technológiájából származik. Az Influenza a/PR/8/34 (H1N1) (10100374) a Charles River Laboratories-tól származik. A Magic Red Cathepsin B vizsgálati készlet (937) az immunkémiai technológiákból származik. A bafilomicin A1 (ab120497) az Abcam-ból származik. 6-TAMRA, speciális készítmény (6-karboxi-tetrametil-rodamin, AS-81122) az ANASPEC-ből származik. A Quikchange II helyszínen irányított mutagenezis készlet (#200523) az Agilent Technologies-től származott. A T7 endonukleáz I (M0302S) a New England BioLabs-ból származik.

PEF-IFITM1, IFITM2, IFITM3 plazmidokat PCR-amplifikációval klónoztuk és pef6-BSD vektorba helyeztük. Az IFITM3 összes mutánsát a QuikChange Multi Site-Directed Mutagenesis Kit (Stratagene) használatával állítottuk elő. A pCAS9 plazmid és a grns basic vector (pGL3-U6) a W. Wei (Pekingi Egyetem)51 ajándékai voltak.

T7E1 vizsgálat

a sejteket grns és cas9 plazmidokkal történő transzfekciót követően Genom extrakció céljából 60-72 órán keresztül lizáltuk. a grns célhelyet Genom PCR primerek alkalmazásával amplifikáltuk (hIFITM3-GF1: AGGAAACT GTTGAGAAACCGAA; hIFITM3-GR1: GCTAGTGGATAGCCGGGGGAC). A PCR termékeket gélen tisztítottuk, majd denaturáltuk és lágyítottuk. A lágyító elegyet T7 endonukleáz I-vel kezeltük 15 percig 37 6c-on, majd a hasítási hatékonyságot gélelektroforézissel ellenőriztük.

IFITM mutáns sejtvonalak létrehozása és jellemzése CRISPR–Cas9

a grns plazmidot úgy állítottuk elő, hogy grns oligókat illesztettünk be egy Pgl3-U6 vektorba Golden Gate ligálással. A sejteket grns-sel, pCas9-vel és pcDNA6-Puro-val transzfektáltuk, 1:1:0,1 arányban (6G). 48 óra elteltével a sejteket leválasztottuk és két részre osztottuk. Az egyik részt lizáltuk a t7e1 vizsgálathoz a specifikus grns hasítási hatékonyságának ellenőrzésére; egy másik részt különböző hígításokkal hat kútlemezre vetettünk. Puromicint adtunk a pozitív klónok kiválasztásához. Egy hétig tartó szelekció után az elválasztott sejttelepeket egy új, 24 lyukú lemezre szedtük ki. Az új sejttelepeket kibővítették és western blot és Genom szekvenálással elemezték a knockout hatékonyságának értékelése érdekében.

western blot analízishez a sejteket nátrium-dodecil-szulfát (SDS) lízis pufferrel (2% SDS, 50 mM-es Tris, 2 mM EDTA) lizáltuk, majd 10 percig forraltuk 98 Ca-n.immunprecipitáció esetén a sejteket Brij pufferrel lizáltuk (0.1 mM trietanol-amin (TEA), 150 mM NaCl, 1% BrijO10 (pH7, 4)), amely EDTA-mentes proteáz inhibitor keveréket tartalmaz, majd anti-ha affinitás gyöngyökkel (Sigma) inkubáljuk. Az összes primer antitestet 1:1000 hígításban, a másodlagos antitestet pedig 1:5000 arányban használtuk.

az IFITM klónok genomi szekvenálásához a teljes genomot a QIAGEN genomkivonó készletével extraháltuk. A cél genomi helyet génspecifikus primerek amplifikálták. Az amplifikált fragmenseket a 3 ‘ végén taq polimerázzal adtuk hozzá, majd T vektorokkal ligáltuk. A transzformáció után tíz baktériumtelepet véletlenszerűen választottak ki és küldtek szekvenálásra.

vírusfertőzések

A549, HeLa, Vero (WHO) és Huh-7,5 sejteket tartottak fenn DMEM-Ben 10% FBS-sel kiegészítve. A549 és HeLa sejteket használtak funkcionális vizsgálatokban (vírusreplikációs vizsgálatokban), míg a Vero és Huh-7.5 sejteket vírustermeléshez és vírus titráláshoz használták. Az összes sejtvonal negatívnak bizonyult a mycoplasma-fertőzés szempontjából, és az ATCC-ből nyerték (kivéve az Huh-7.5-et, amely a Chisari laborból származott (Scripps Research Institute, La Jolla, CA)).

a HeLa vagy A549 sejteket influenza a/PR/8/34 vírussal (H1N1) fertőztük meg 2,5-es MOI-val 12 órán át. a fertőzött sejteket PBS-sel mostuk és 0,25% tripszin-EDTA-val gyűjtöttük be. A sejteket 3,7% paraformaldehidben (PFA) rögzítettük 10 percig, majd 0,1% Triton X-100-mal áthatoltuk 10 percig. A sejteket influenzaellenes nukleoprotein (NP) antitesttel (1:333; Abcam, ab 20343) festettük, és közvetlenül az Alexa-Fluor 647-hez konjugáltuk egy 100g-os antitestcímkéző készlet (Invitrogen) segítségével. Az összes antitestet 0,1% Triton X-100-ban hígítottuk PBS-ben, és a sejteket 20 percig festettük. A sejteket minden antitestkezelés után kétszer 0,1% Triton X-100-mal mossuk PBS-ben. A PBS-t a sejtek végső reszuszpendálásához használták citometriai elemzés a FACS Canto II áramlási citométer (BD Biosciences).

a HeLa vagy A549 sejteket 24 lyukú lemezekbe (5 604 sejt/kút) vetettük be, és egy éjszakán át (16 óra) inkubáltuk IFN-6 jelenlétében vagy hiányában 100 g/mL koncentrációban. Ezután a sejteket Opti-MEM-Mel (gibco) mossuk a fertőzés előtt. A vírusokat Opti-MEM – Mel hígítottuk a jelzett Moi-knál, és a sejteket 2 órán át oltottuk 37cc-n. Inkubálást követően a vírusoltást eltávolították, és a dmem ismételt hozzáadása előtt a tenyészeteket háromszor Opti-MEM-Mel mostuk. Az IFN-61 kezelést a kísérletek során végig folytattuk. A GFP-vel jelölt vírusokkal fertőzött sejteket a megjelölt időpontokban gyűjtöttük be a fertőzés áramlási citometriával történő mérésére. A következő vírusok vírusállományainak generálását korábban leírták: YFV-Venus52 (yf17d-5 ‘ C25venus2aubi-ból származik), WNV-GFP53 (pbelo-WNV-GFP-RZ ic-ből származik), DENV-GFP54 (ic30p-A-ból származik, az 16681 törzs teljes hosszúságú fertőző klónja), VEEV-GFP55 (pTC83-GFP fertőző klónból származik), ONNV-GFP56 (az fertőző klón PONNV.GFP) és VSV-GFP(nagylelkűen J. Rose, Yale). ZIKV (a PRVABC59 a CDC-től származik, Ft. Collins) amplifikálták Huh-7,5 sejtekben és titerezték plakk teszttel Huh – 7,5 sejteken. A WNV-vel végzett kísérleteket a biológiai biztonság 3. szintű (BSL3) elszigetelésében végezték az intézményi és szövetségi irányelveknek megfelelően. A fertőzött sejteket 300 6L accumax sejt disszociációs táptalajba (eBioscience) gyűjtöttük, és egy 96 lyukú, 300 4% PFA-t tartalmazó blokkba helyeztük át. A sejteket pellet 930 r.c.f. – on 5 percig 4 6c. – on, 3% FBS-t tartalmazó hideg PBS-ben reszuszpendáltuk, és 4 oc. – on raktároztuk a FACS analízisig. A zikv-vel fertőzött sejteket a fent leírtak szerint betakarítottuk, majd ezt követően monoklonális antitest alkalmazásával festettük flavivírus csoport antigén 4G2 (Millipore) at 1:500 elsődleges antitestként és anti-nyúl Alexa-Fluor 594 1:1000-nél másodlagos antitestként. A sejteken kívül a zikv-fertőzésekből származó felülúszókat gyűjtötték be a vírus titerek meghatározására standard plakkvizsgálattal, amelyet Huh-7,5 sejteken végeztek. Az összes mintát 488 nm-es és 561 nm-es lézerrel felszerelt lsrii áramlási citométerrel (BD Biosciences) elemeztük a GFP, YFP (Venus) és RFP kimutatására. Az adatokat flowjo szoftver (Treestar) segítségével elemeztük, 0,1% – os kompenzációs mátrixszal.

fluoreszcens mikroszkópia

a sejteket üvegborítókon, hat lyukú lemezeken tenyésztettük. A kezelések után a sejteket kétszer PBS-sel mossuk, 4% PFA-val rögzítjük 10 percig, 0,2% Triton X-100-mal permeabilizáljuk 10 percig, 1% szarvasmarha szérum albuminnal blokkoljuk (BSA, Roche, 735094) 1 órán át, és primer antitesttel inkubáljuk nyúl anti-IFITM3 (1:100 1% BSA-val hígítva; Proteintech csoport, 11714-1-AP) 1,5 órán át, majd másodlagos antitest anti-rabbit-Alexa fluor 647 konjugátum (1:1000; abcam, ab150083) 1 órán át szobahőmérsékleten. Végül a fedőlapokat dapi-t tartalmazó rögzítő közeg segítségével tárgylemezekre szereltük, majd a sejteket invertált LSM 780 lézerszkennelő konfokális mikroszkóppal (Zeiss) vizsgáltuk.

exogén rakományfelvételi vizsgálatok

a sejteket 45 percig széruméhben ÉHEZTETTÜK DMEM-ben 37 6CC-n, majd 5 percig jégen inkubáltuk, amelyet 50 g/ml Alexa-Fluor 647-konjugált transzferrin (Invitrogén) hozzáadása követett DMEM-ben. 30 perc után jégen, a sejteket 37-re helyeztük át kb 7 percig vagy 20 percig, pelletálva, jéghideg PBS-ben mosva, savval mosva (0.1 M glicin és 150 mM NaCl 3-as pH-n) kétszer, egyszer PBS-sel mosva, majd fixálva (tömeg / térfogat 3% PFA és 4% szacharóz PBS-ben) az áramlási citometriás elemzés előtt, a fent leírtak szerint.

a dfTAT felvételének és redukciójának elemzése

a dfTAT (dimer fluoreszcens tat) Y.-C. Wang általi szintézisét a korábban leírtak szerint végeztük39. Előkezelés után 100 Ft/ml IFN-Ft-tal vagy anélkül 16 órán át, a sejteket inkubáltuk 2 Ft / ml DFTAT-tal DMEM-ben a megadott ideig, jégre helyeztük és háromszor jéghideg PBS-sel mossuk, majd áramlási citometriás elemzés vagy fluoreszcens mikroszkópia előtt rögzítettük (wt/vol 3% PFA és 4% szacharóz PBS-ben).

az EGFR és a TfR forgalom elemzése

a sejteket 80%-os összefolyásig tenyésztettük, kétszer PBS-sel mostuk és szérummentes DMEM-ben éheztettük 2 órán át 37 db C-on, hogy maximalizáljuk a felszíni EGFR-t, majd szérummentes DMEM-ben 10-25 db/ml cikloheximiddel előkezeltük 1 órán keresztül, megakadályozva az új EGFR szintézisét az EGF stimulálása során. Közvetlenül ezután a sejteket folyamatosan stimuláltuk 100 ng/ml EGF-vel 15, 30, 60 vagy 120 percig cikloheximid jelenlétében. Az EGFR és a tubulin szintjét western blot-tal határoztuk meg. Sejtfelszíni festési kísérletekhez a sejteket primer anti-EGFR antitesttel (Abcam, ab32077) inkubáltuk jégen 40 percig, majd háromszor PBS-sel mossuk. Az Alexa-Fluor 647 konjugált másodlagos antitesteket (Abcam, ab150083) ezután a sejtekkel 40 percig inkubáltuk jégen, majd háromszor PBS-sel mossuk. A sejteket 2% FBS-ben szuszpendáltuk a PBS-ben, és azonnal elemeztük áramlási citometriával.

a TFR-átfordulási kísérletekben a sejteket 80%-os összefolyásig tenyésztettük, kétszer PBS-sel mostuk és szérummentes DMEM-ben éheztettük 2 órán át 37 6CC-n, majd szérummentes DMEM-ben 10-25 g/ml cikloheximiddel előkezeltük 1 órán át, megakadályozva az új TfR szintézisét. Közvetlenül azután, a sejteket folyamatosan stimuláltuk 20 db-tal (0, 30, 60, 120 vagy 180 min) cikloheximid jelenlétében. A TFR, az IFITM3 és a tubulin szintjét western blott-tal határoztuk meg.

késői endoszóma és lizoszóma fúziós vizsgálat

a sejteket 4 órán át inkubáltuk 25 MHz/ml phrodovörös dextránt tartalmazó táptalajban, majd 20 órán át fluorofórmentes táptalajban, hogy elősegítsük a dextrán lizoszomális felhalmozódását. A sejteket ezután inkubáltuk 50-et tartalmazó táptalajbangg / ml dextrán-Alexa Fluor 488 10 percig 37 Kb-on, mielőtt fluorofórmentes táptalajjal helyettesítenénk. A megjelölt időpontokban a sejteket jéghideg 4% PFA-val rögzítettük immunfluoreszcens festéshez.

lizoszomális proteázaktivitási vizsgálatok

a katepszin B aktivitást a katepszin B aktivitási készlet segítségével vizsgáltuk a gyártó által megadott protokoll szerint. Az IFN-6-os kezelés után 16 órán át bafilomicin A1-vel vagy anélkül a sejteket mágikus vörössel (1:26) inkubáltuk 30-60 percig 37 6CC-n, mielőtt kétszer mossuk PBS-sel. A sejteket ezután 4% PFA-val rögzítettük, majd áramlási citometriával elemeztük.

a katepszinek Aktivitásalapú címkézését (Vergent Bioscience, Pan Cathepsin szonda) a korábban leírtak szerint végeztük kisebb módosításokkal57. Röviden, a sejteket a címkézés előtt 24 órával vetettük be,a sejteket pedig a címkézés előtt IFN-6 6 órával aktiváltuk. A táptalajt kicserélték, és a sejteket 1 db 6 órás iabp Pan katepszin szondával kezelték. a sejteket PBS-sel mostuk és jégen hipotóniás lízis pufferrel lizáltuk (50 mM-es csövek pH 7,4, 10 mM KCl, 5 mM MgCl2, 2 mM EDTA, 4 mM DTT, 1% NP-40). A sejttörmeléket úgy távolítottuk el, hogy a lizátumokat 500 g–on 5 percig, 4 c-n át forgattuk.a Felülúszókat ezután 4x minta betöltő pufferrel kevertük, és az összes fehérje 70g-ját SDS-PAGE-vel elemeztük. A gélt kétszer mossuk ionmentesített vízzel, mielőtt gélen belüli fluoreszcencia elemzést végeznénk egy Bio-Rad ChemiDoc MP képalkotó rendszeren, és coomassie festést vagy transzfert végeznénk western blot analízis céljából.

did-a

tisztított influenzavírus a/PR/8/34 (H1N1) és rekombináns VSV expresszáló LASV GPC (a korábban leírtak szerint előállított41) a lipofil festék 1,1′-dioktaktadecil-3,3,3′,3′-tetrametilindodikarbocianin (did, Life Technologies) önkioltó koncentrációival jelöltük. Tisztított vírus (1 mg / ml) a PBS-ben inkubáltuk 50 6db DiD, miközben keverjük 1 órán át 4 6db C. vírus volt elválasztva a felesleges festéket ultracentrifugálással keresztül 10% – os szacharóz párna 2 órán át 107 000 g és 4 0db C egy SW41 rotor (Beckman Coulter). A jelzett vírus pelleteket PBS-ben reszuszpendáltuk 1 mg/ml vírusfehérje-koncentrációban, alikvotáltuk, és -80 6c-on tároltuk a felhasználásig.

az IFITM3 helyspecifikus címkézése emlős sejtekben

az élő sejtes képalkotó vizsgálatokhoz a HeLa sejteket 35 mm-es üvegfenék edényekre vetettük be, hogy a következő napon a képalkotáshoz körülbelül 70%-os összefolyás legyen. Az adhéziót követően a sejteket TRANSZFEKTÁLTUK a HA-IFITM3-TAG variánst tartalmazó plazmiddal (edényenként 1 ~ g) és az Mm-PylRS-AF/Pyl-tRNACUA plazmiddal (edényenként 1 ~ g), 3 ~ ~ Viafect (Promega) alkalmazásával, természetellenes aminosavakat (TCOK) tartalmazó teljes sejtnövekedési közegben. Éjszakai inkubálás után a sejtközegeket friss sejtnövekedési közeggé változtattuk TCOK nélkül. Egy másik 2 órás tenyésztés után 37 6/5% CO2-on a sejteket tetrazin-fluoroforokkal (250 nM) jelöltük Fluorobrit DMEM-ben (Life Technologies) 30 percig 37 mm-en, és 1 óra alatt háromszor teljes sejtnövekedési közeggel mossuk.

élő sejtes képalkotás

széles terepi epifluoreszcens mikroszkópia esetén a sejteket celllight vektorokkal (Life Technologies) transzdukáltuk korai endoszómákra (RFP-Rab5), késői endoszómákra (RFP-Rab7) vagy lizoszómákra (RFP-Lamp1) körülbelül 18 órával a képalkotás előtt, a gyártó utasításainak megfelelően. Az élő sejtes mikroszkópiát az Axioobserverrel korábban leírtak szerint végeztük.Z1 széles látószögű epifluoreszcens mikroszkóp (Zeiss), amely 40 db/ 1,3 N. A. objektívvel, dapi/GFP/Texas Red/Cy5 szűrőkészlettel és 37 dB 6C-os fűtött környezeti tartállyal van felszerelve. A HeLa sejt egyrétegeket fibronektinnel bevont 35 mm-es üvegborító edényekre (MatTek) vetettük be 24 órával a kísérletek előtt. A sejteket jégen hűtöttük néhány percig, mielőtt a DiD-vel jelölt vírus spinokulációját monolayerekre 1500 g-on és 6 C-on 20 percig. A nem kötött részecskéket öt mosással távolítottuk el hideg PBS-sel, és 500 db (140 mM-es NaCl, 2,5 mM-es KCl, 1,8 mM-es MgCl2, 20 mM-es HEPES, 5 mM-es szacharóz, 2 mm-es Hoechst 33342 és 2% – os FBS) hideg képalkotó puffert adtunk a sejtek fedésére. Az edényt azonnal a mikroszkóp objektívre szerelték és fókuszálták. A fedőlemezt ezután elárasztották 1.5 ml meleg képalkotó puffer a kísérletek kezdetének megjelölésére (t = 0). A képeket a kísérletek időtartama alatt minden 10 másodpercben egyetlen Z-szakasz segítségével szereztük be, amely szinte az összes sejthez kapcsolódó részecskét felölelte.

konfokális mikroszkópiához a HeLa sejteket 35 mm-es üvegfenekű edényekbe (UO. A következő napon a sejteket transzfektáltuk a HA-IFITM3-TAG variánst tartalmazó plazmiddal (edényenként 1 ~ g) és az Mm-PylRS-AF / Pyl-tRNACUA plazmiddal (edényenként 1 ~ g), 6 ~ ~ Lipofektamin 3000-et használva TCOK-ot tartalmazó teljes sejtnövekedési közegben. 16 órás inkubálás után a sejtközegeket friss sejtnövekedési közeggé változtattuk TCOK nélkül. Egy másik 6 órás tenyésztés után 37 6CC/5% CO2-on, a sejteket tetrazin-BODIPY-vel (500 nM) jelöltük Fluorobrit DMEM-ben (Life Technologies)/10% FBS 0,5 órán át 37cc-n, és Fluorobrit DMEM-vel (Life Technologies)/10% FBS-vel mossuk négyszer 2 óra alatt. végül a sejteket nucblue élő Sejtfestékkel (Life Technologies) festettük 20 percig, és FluoroBrite DMEM-Ben/10% FBS-ben konfokális mikroszkópia. A plazmamembrán festéséhez a sejteket Cellmask Red-vel festettük (1:1000, Life Technologies) Live Cell Imaging oldatban (LCIS) 5 percig 37cc-n, majd háromszor LCIS-sel mossuk, mielőtt nucblue Live Cell folttal festenénk. A sejteket invertált LSM 780 lézerszkennelő konfokális mikroszkópon (Zeiss) képeztük Zeiss Plan-Apochromatic 63 dB/1,4 N. A. olajimmerziós objektívvel. A mikroszkópot egy színpad tetején lévő inkubátorral szerelték fel, amelyet 37-re állítottak be 6CC/5% CO2 élő sejtes képalkotáshoz. A Hoechst-et egy 405 nm-es lézerrel gerjesztették, amelynek emissziós spektruma 410-480 nm között volt. A Tz-BODIPY-t egy 488 nm-es lézerrel gerjesztették, amelynek emissziós spektruma 490-550 nm között volt. A CellMask Red-et egy 561 nm-es lézerrel gerjesztették, amelynek emissziós spektruma 570-620 nm között volt. A képeket a Zen blue 2012 szoftverrel (Zeiss) szerezték be, és az ImageJ (NIH) elemezte. Pearson korrelációs együtthatóit az ImageJ-ben számítottuk ki a Coloc 2 plugin segítségével.

Adatelemzés

a képelemzést és az egyrészecske-követést a Volocity szoftver (PerkinElmer) segítségével végeztük el, amint azt korábban leírtuk41. A képfájlokat nem manipulálták, kivéve a fényerő és a kontraszt kisebb módosításait. A virális puncta küszöbértékét a kezdeti intenzitás és méret határozta meg. Az egyes DiD-vel jelölt virionoktól várt 0,25-1 MHz-es tartományon kívül eső Puncta-t kizárták az egyrészecskés elemzésből. A virionokat csak akkor tekintették kolokalizáltnak LAMP1 vagy IFITM3-mal, ha a celluláris marker punctum 30% – kal vagy annál nagyobb mértékben haladta meg a háttérjelet, és ha a GFP vagy a BODIPY és a puncta több mint 70% – os átfedésben volt a jelekkel. Átlagos mérések (Ca.d.) három külön kísérletből származtak, hacsak másként nem jelezzük.

ha-IFITM3-TCOK expressziós szintek elemzése

a western blot analízishez a HeLa sejteket hat lyukú lemezekbe vetettük, és egy éjszakán át tenyésztettük. Az IFITM2/3-KO sejteket TRANSZFEKTÁLTUK HA-IFITM3-F8TAG-mal (2,5 6G) és Mm-PylRS-AF/Pyl-tRNACUA-val (2,5 g) TCOK (50 m) jelenlétében 16 órán át. a Hela WT sejteket kezeletlenül hagytuk vagy IFN-6 (100 ng/ml) 16 órán át IFITM3-mal kezeltük. az IFITM3 szinteket western blotting módszerrel határoztuk meg nyúl anti-IFITM3 alkalmazásával (1:1000; Proteintech csoport, 11714-1-AP) és szekunder antitest HRP-konjugált kecske anti-nyúl IgG (HCL; 111-035-003).

az immunfluoreszcencia analízishez az IFITM2/3-KO sejteket HA-IFITM3-F8TAG-Gal (1 .. g) és Mm-PylRS-AF/Pyl-tRNACUA-val (1 .. g) transzfektáltuk TCOK (50 .. m) jelenlétében 16 órán át. a Hela WT sejteket kezeletlenül kezeltük vagy IFN-6 (100 ng/ml)-vel kezeltük 16 órán át. a sejteket ezután formaldehiddel rögzítettük, permeabilizáltuk szaponinnal (0,5%) és nyúl anti-ifitm3-mal (1:100) (proteintech csoport, 11714-1-AP) és anti-nyúl-Alexa fluor 647 konjugátummal (1:1000) (Abcam, ab150083) konfokális fluoreszcencia képalkotáshoz. A hoescht (kék) a magok festésére szolgál. A sejteket invertált LSM 780 lézerszkennelő konfokális mikroszkópon (Zeiss) képeztük Zeiss Plan-Apochromatic 63 ++ /1,4 olajimmerziós objektívvel. A képek azonos konfokális mikroszkóp beállításokkal készültek.

az áramlási citometriás elemzéshez az IFITM2/3 KO sejteket TRANSZFEKTÁLTUK HA-IFITM3-F8TAG-val (1 6G), Mm-PylRS-AF//Pyl-tRNACUA-val (10 g), TCOK (50 m) jelenlétében 16 órán keresztül. a Hela WT sejteket IFN-6 (100 ng/ml) – nel vagy anélkül kezeltük 16 órán keresztül. A sejteket kétszer mostuk PBS-sel, majd 400 db 6% PFA-s PBS-sel rögzítettük 10 percig. A rögzített sejteket 200 0,2% szaponinnal permeabilizáltuk PBS-ben 10 percig, majd 200 0,2% BSA-val és 0,2% szaponinnal blokkoltuk PBS-ben 10 percig. A sejteket nyúl anti-IFITM3-mal (1:300) (Proteintech csoport, 11714-1-AP) és anti-nyúl-Alexa Fluor 647-Tel (1:1000) (Abcam, ab150083) kezelték PBS-ben 0,02% szaponinnal. Három PBS-sel végzett mosás után a sejteket 150 db 6,2% BSA-val és 0,02% szaponinnal reszuszpendáltuk. A mintákat áramlási citometriával (BD LSRII) elemeztük. Az adatok elemzését FLowJo szoftver segítségével végeztük.

IFITM3 Cys mutánsokkal végzett iav-fertőzést

IFITM2/3 KO HeLa sejteket 12 kútlemezbe (Corning) vetettünk be, és egy éjszakán át tenyésztettük. A sejteket együtt transzfektáltuk HA-hIFITM3 konstrukciókkal (1 ~ g/well) és az Mm-PylRS-AF/Pyl-tRNS plazmiddal (1 ~ g/well), 3 ~ ~ Lipofektamin 3000 alkalmazásával 1 ml teljes sejtnövekedési közegben, amely 10 ~ 100 mM Bock-ot tartalmaz (végső koncentráció 1 mM). 16 óra elteltével a sejteket influenzavírus a/PR/8/34 vírus (H1N1) fertőzte meg 5 MOI-val. 6 óra fertőzés után a sejteket tripszinizáltuk és klasztercsövekbe gyűjtöttük (Corning). A sejteket kétszer mostuk PBS-sel, majd 400 db 6% PFA-s PBS-sel rögzítettük 10 percig. A rögzített sejteket 200 0,2% szaponinnal permeabilizáltuk PBS-ben 10 percig, majd 200 0,2% BSA-val és 0,2% szaponinnal blokkoltuk PBS-ben 10 percig. A sejteket az AlexaFluor-647-hez konjugált anti-influenza NP antitesttel és az Alexa-fluor-594-hez konjugált anti-HA antitesttel (1:250) kezelték PBS-ben 0,02% szaponinnal. Három PBS-sel végzett mosás után a sejteket 150 db 6,2% – os BSA-val és 0-val reszuszpendáltuk.02% szaponin. A mintákat áramlási citometriával (BD LSRII) elemeztük. Az összes mintát először HA-pozitív festéssel kapuztuk, jelezve a sikeres transzfekciót, majd NP-az NP-pozitív festés pozitív százaléka, jelezve a sikeres fertőzést. A HA-tag epitóp egy H3 influenzavírus törzsből származik, és nincs jelen a H1N1 influenzavírus PR8 törzsében. Az adatok elemzését FLowJo szoftver segítségével végeztük.

S-palmitoilációs vizsgálatok

a sejtek Alkin-palmitinsav riporterrel történő metabolikus jelölését az előzőekben leírtaknak megfelelően végeztük58 néhány módosítással. Az Alk-16-ot és az-rho-t szintetizálták a korábbi jelentések szerint58. Az IFITM2 / 3 KO HeLa sejteket ha-hIFITM3 konstrukciókkal transzfektáltuk a fent leírtak szerint. 16 óra elteltével a sejteket inkubáltuk 50 6db alk-16-mal DMEM-ben, amely 10% FBS-t tartalmaz 2 órán át. a sejteket betakarítottuk, egyszer PBS-sel mostuk, és 1% Brij 97-ben (Sigma) lizáltuk 50 mM-es teában, 150 mM NaCl pH 7,4-ben, 1x Roche proteáz inhibitorban és 1500 egység/ml benzonázban (EMD). A fehérjekoncentrációkat a BCA assay segítségével határoztuk meg. A immunoprecipitation, 150 µg az összes fehérje ki, hogy 20 µl anti-HA antitest-konjugált agaróz (Sigma) egy teljes mennyisége 150 µl, majd megrázta a 4 °C, 1 h. Agaróz gyöngyök voltak mosott reszuszpendálás 500 µl 50 mM HEPES puffer (tartalmazó, 150 mM NaCl, pH 7.4) centrifugálással 3,500 × g 30 s. A gyöngyök voltak, akkor újraszuszpendált 45 µl a fenti puffer, 5 µl CuAAC reagenshez kovalens kötéssel kapcsolódnak megoldás (0.5 µl 10 mM-azido-rodamin (végső koncentrációja 100 µM), 1 µl 50 mM-es, frissen készített CuSO4·5H2O a H2O (végső koncentráció 1 mM, Sigma), 1 µl 50 mM-es, frissen készített TCEP (végső koncentráció 1 mM) 2, 5 µl 10 mM Trisamine (TBTA) (végső koncentrációja az 500 µM)) egészült ki. A mintákat szobahőmérsékleten 1 órán át ráztuk, majd RIPA pufferrel kétszer mossuk. Laemmli mintapuffert (20 6L) adtunk a mintákhoz (1,0: 1,3 a puffer aránya a mintához), amelyeket 10 percig hevítettünk 95 oC-on, majd gélelektroforézissel elválasztottuk. A gélen belüli fluoreszcencia szkennelést Bio-Rad ChemiDoc MP képalkotó rendszerrel végeztük. A Ha-jelölt fehérjék Western blotjait anti-HA HRP konjugált antitest (1:1000; Roche) alkalmazásával végeztük. A fluoreszcens gélekben és western blotokban a sávintenzitás számszerűsítését Image Lab (Bio-Rad) segítségével végeztük. Három biológiai replikáció adatait számszerűsítettük és átlagoltuk az ábrázoláshoz.

jelentés összefoglaló

a kutatási tervezéssel kapcsolatos további információk a cikkhez kapcsolódó Nature Research Reporting Summary-ban találhatók.

Posted on

Vélemény, hozzászólás?

Az e-mail-címet nem tesszük közzé.